View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_62 (Length: 237)
Name: NF1583_low_62
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31231702 - 31231922
Alignment:
| Q |
1 |
acaacactaaaactataatctaactattctctaattcttatttccttccccctctctttgtcgacacaactttcttcgccggagacttcttagctgccac |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31231702 |
acaacactaaaactataagctaactattctctaattctcatttccttccccctctctttgtcgacacaactttcttcaccggagacttcttagctgccac |
31231801 |
T |
|
| Q |
101 |
agctttcttcaccggagctttcttagcagccacagctttcttcactgctggcttcttagcagcaacaactttcttccccggagttgtcctcgtcgacgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31231802 |
agctttcttcaccggagctttcttagcagccacagctttcttcactgctggcttcttagcagcaacaactttcttccccggagttgtcctcgtcgacgtc |
31231901 |
T |
|
| Q |
201 |
cttgaagccttagcaggtttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31231902 |
cttgaagccttagcaggtttc |
31231922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2223 times since January 2019
Visitors: 5793