View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_66 (Length: 233)
Name: NF1583_low_66
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 30219314 - 30219506
Alignment:
| Q |
19 |
atgaaccaaaaccacgatagacgctttatg------accacctccaattaattttcaactttgcctttaaagagaacattattactgcgctccatccaaa |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30219314 |
atgaaccaaaaccaccatagacgctttatgcgatcgaccacctccaaataatttacaactttgcctttaaagagaacattattactgcgctccatccaaa |
30219413 |
T |
 |
| Q |
113 |
tatataatacggaagtaatgtacatgattctatggccttgctcgagcttcaaattccaaatcatacttttcatcaaaaagtaaaagtaagaac |
205 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30219414 |
tatataatacggaagtaatgtacatcattctatggtcttgctcgagcttcaaattccaaatcatacttttcatcaaaaagtaaaagtaagaac |
30219506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University