View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1583_low_72 (Length: 207)
Name: NF1583_low_72
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1583_low_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 108 - 189
Target Start/End: Original strand, 19371016 - 19371097
Alignment:
| Q |
108 |
cctgctaccacggggcataaatagtgtactgcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgct |
189 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19371016 |
cctgctaccttggggcataaatagtgtacagcttttgcttcacttaaatgataaatctcaatctatcattctagtgtttgct |
19371097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10656 times since January 2019
Visitors: 6103