View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584-INSERTION-3 (Length: 135)
Name: NF1584-INSERTION-3
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584-INSERTION-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 1e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 21387203 - 21387077
Alignment:
| Q |
8 |
aatttggtgttcattcagtggaccaaaggttgagaggtggtggaagctgtatgagtattagaatgggccctttttgggtgtggctcagctatggtgatgc |
107 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||| |||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21387203 |
aatttggtgttcgttcagtggaccggaggttgagatgtgatggaagttgtatgaatattagaatgtgccctttttgggtgtggctcagctatggtgatgc |
21387104 |
T |
|
| Q |
108 |
gaccaaggtgtttcgatttcaaggggt |
134 |
Q |
| |
|
||||| ||||||| ||||| ||||||| |
|
|
| T |
21387103 |
gaccagggtgttttgatttaaaggggt |
21387077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 26386174 - 26386074
Alignment:
| Q |
8 |
aatttggtgttcattcagtggaccaaaggttgagaggtggtggaagctgtatgagtattagaat-gggccctttttgggtgtggctcagctatggtgatg |
106 |
Q |
| |
|
|||||||||||| ||| |||||| | | ||||||||||||||| ||| |||||||||| || || || |||||||||||| ||||||||||| |||| |
|
|
| T |
26386174 |
aatttggtgttctttcgatggaccggatgatgagaggtggtggaaactgactgagtattagtataggaccttttttgggtgtgactcagctatggagatg |
26386075 |
T |
|
| Q |
107 |
c |
107 |
Q |
| |
|
| |
|
|
| T |
26386074 |
c |
26386074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 22885130 - 22885087
Alignment:
| Q |
10 |
tttggtgttcattcagtggaccaaaggttgagaggtggtggaag |
53 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
22885130 |
tttggtgttctttcggtggaccagaggttgagaggtggtggaag |
22885087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 27740059 - 27740101
Alignment:
| Q |
10 |
tttggtgttcattcagtggaccaaaggttgagaggtggtggaa |
52 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
27740059 |
tttggtgttctttcggtggaccagaggttgagaggtggtggaa |
27740101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 33788629 - 33788583
Alignment:
| Q |
10 |
tttggtgttcattcagtggaccaaaggttgagaggtggtggaagctg |
56 |
Q |
| |
|
|||||||||| ||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
33788629 |
tttggtgttctttcggtgaaccagaggttgagaggtggtggaagctg |
33788583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 27905506 - 27905549
Alignment:
| Q |
25 |
gtggaccaaaggttgagaggtggtggaagctgtatgagtattag |
68 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27905506 |
gtggaccggaggttgagaggtggtggaagctgtatgagcattag |
27905549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 33 - 61
Target Start/End: Original strand, 7104950 - 7104978
Alignment:
| Q |
33 |
aaggttgagaggtggtggaagctgtatga |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7104950 |
aaggttgagaggtggtggaagctgtatga |
7104978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 823431 - 823380
Alignment:
| Q |
10 |
tttggtgttcattcagtggaccaaaggttgagaggtggtggaagctgtatga |
61 |
Q |
| |
|
|||||||||| ||| || ||||| |||||||||||||| |||||||| |||| |
|
|
| T |
823431 |
tttggtgttctttcggtagaccagaggttgagaggtggcggaagctgaatga |
823380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University