View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584-INSERTION-6 (Length: 660)
Name: NF1584-INSERTION-6
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584-INSERTION-6 |
 | |
|
| [»] scaffold0208 (4 HSPs) |
| |
|
Alignment Details
Target: scaffold0208 (Bit Score: 63; Significance: 5e-27; HSPs: 4)
Name: scaffold0208
Description:
Target: scaffold0208; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 570 - 660
Target Start/End: Complemental strand, 3579 - 3489
Alignment:
| Q |
570 |
tctaagttgatccattgaaagaggcaaaaactggattgttatttatgaacaaatgttcaatgcagctaaagcttcattccagatgttatga |
660 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
3579 |
tctaagttgatccattgaaagaggcaaaaactagatccttatttatgaacaaatgttcaatgctgctaaagctttattccagcggttatga |
3489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 57 - 349
Target Start/End: Complemental strand, 13586 - 13295
Alignment:
| Q |
57 |
ttcagctgaagtttctatcaaataattactacaaaccgaagttcaagaagctagtcataatcacttgttgccaattagaagatttacttattctctaact |
156 |
Q |
| |
|
||||||| ||||||| |||||||||||| || ||||| ||||||||| || |||| ||| |||||||||||||| || ||||| |||||| |||||| |
|
|
| T |
13586 |
ttcagctaaagtttcagtcaaataattacaaccaaccggagttcaagaggccagtcttaaatacttgttgccaattggataatttatttattcactaact |
13487 |
T |
|
| Q |
157 |
tgtttccttttgtttagtgttttttacacccatatgattgtccaaattttaggacgagatcatgttttatacaagaatcttttgcaagaattggttc-aa |
255 |
Q |
| |
|
| | ||||| ||||||||||| ||||||||||||| |||||||||||| | ||| || | ||||||| |||| |||| ||||||||||| || |
|
|
| T |
13486 |
tat--------gtttattgttttttacatccatatgattgtctaaattttaggacaaaatcgtggtatatacaaaaatcgtttgtgagaattggttcaaa |
13395 |
T |
|
| Q |
256 |
agaacgggcttctgttgtccgtttacatccataaatctgg-cagggtcaca------tatttacttcacaagtggagatggaaaagtacaagtagagcta |
348 |
Q |
| |
|
|| | | || |||| || |||||||| |||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13394 |
aggaatgaatttagttg-ccatttacatctataaatctggtgagggtcacaagcctgtatccacttcacaagtggagatggaaaagttcaagtagagcta |
13296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 412 - 478
Target Start/End: Complemental strand, 3855 - 3789
Alignment:
| Q |
412 |
ttacaaatttattcattccttaagaattggttgaattattcttgatatacacatcacgatctcaaaa |
478 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
3855 |
ttacaaatttattcatttcttaagaattcgttgaattattcttaatatacacatcatgatctcaaaa |
3789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0208; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 366 - 413
Target Start/End: Complemental strand, 6003 - 5956
Alignment:
| Q |
366 |
tgtaggtgagtttcactttccttgattggttcatcttataattttgtt |
413 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6003 |
tgtaggtgattttcactttccatgatcagttcatcttataattttgtt |
5956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University