View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584-INSERTION-8 (Length: 253)
Name: NF1584-INSERTION-8
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584-INSERTION-8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 253
Target Start/End: Original strand, 21700951 - 21701196
Alignment:
| Q |
7 |
agacatttactaatccatgaattgatgtgattccacacttggtccttaatgtagccaaacgttgactttttatctctatcgatcattgatggtaacctca |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
21700951 |
agacatttactaatccatgaattgatgcgattccacacgcggtccttaatttagccaaacgttgaatttttatctctatcgatcattgatggtaacc-ca |
21701049 |
T |
|
| Q |
107 |
gatatttaccagtacccaacacagactggacacccattgtgtcagctattgtacctttcaattcagacgaaacattacgactatagtaaatctctaattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| | |||| |
|
|
| T |
21701050 |
gatatttaccagtacccaacacagactggacacccattgtgtcagctattgtacctttcaattcagatgaaacattacgactacagtaaatctttgattt |
21701149 |
T |
|
| Q |
207 |
tgggagactaataggctggcctgacactgcctcataaaccgttagaa |
253 |
Q |
| |
|
||| |||||||||| || || ||||||||||||||||||||||||| |
|
|
| T |
21701150 |
tggaagactaatagcttgtcccgacactgcctcataaaccgttagaa |
21701196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University