View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15840_high_18 (Length: 233)
Name: NF15840_high_18
Description: NF15840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15840_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 836787 - 836564
Alignment:
| Q |
1 |
tttttaatcataatccaaatttacctgcgagagtatttaaatttttggatttgatgatatttttgtccttataactgatcaccatgaacaactctactct |
100 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
836787 |
tttttaatgataatccaaat----ctgcgagagtatttaaatttttggatttaatgatatttttgtccttataactgatcaccatgaacacctctactct |
836692 |
T |
 |
| Q |
101 |
gttcattaagcaattccttgttaggggctaatatagcaactttattnnnnnnnnntctaataaacaatatttgtttattcaaattggtaaagtacattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
836691 |
gttcattaagcaattccttgttaggggctaatatagcaactttatt-aaaaaaaatctaataaacaatatttgtttattcaaattggtaaagtacattga |
836593 |
T |
 |
| Q |
201 |
tataacacacgct-acattgttgatgatg |
228 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |
|
|
| T |
836592 |
tataacacacgctcacattgtcgatgatg |
836564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 38379420 - 38379462
Alignment:
| Q |
160 |
ataaacaatatttgtttattcaaattggtaaagtacattgata |
202 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
38379420 |
ataaacgatatttatttattcaaattgataaagtacattgata |
38379462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University