View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15840_high_19 (Length: 225)
Name: NF15840_high_19
Description: NF15840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15840_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 46438174 - 46438370
Alignment:
| Q |
14 |
tgaagaagaaataattccactctgcaggtatataagttgaaatgttttctgctcatatagcactagttacaatgatactcaagta----tatcataaatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46438174 |
tgaagaagaaataattccactctgcaggtatattagttgaaatgttttctgctcatatagcactagttacaatgatactcaagtacgtatatcataaatt |
46438273 |
T |
 |
| Q |
110 |
gtttttattgttactaagaagctttgtgtacttgcagagagcttggcattggaattgtagcatacagcccccttggtcgcggcttttttgcaggaaa |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46438274 |
gtttttatcgttactaagaagctttgtgtacttgcagagagcttggcattggaattgtagcatacagcccccttggtcgcggcttttttgcaggaaa |
46438370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University