View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15840_high_21 (Length: 218)
Name: NF15840_high_21
Description: NF15840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15840_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 42242529 - 42242321
Alignment:
| Q |
1 |
ccttccaatgttcatcaaatataaatatattgctagtatttaaacatccatcatttctattacaacatgttcaatggcaataatgtgttatttgagtggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42242529 |
ccttccaatgttcatcaaatataaatatattgctagtatttaaacatccatcatttctattacaacatgttcaatggcaataatttgttatttgagtggg |
42242430 |
T |
 |
| Q |
101 |
nnnnnnnnntcgaagatgagattctcttgtaaaataaagctcta---gtctgcgatgcttgaatctggccttttatttttcccatggcgtgattctttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42242429 |
aaaaaaaaatcgaagatgagattctcttgtaaaataaagctctagacgtctgcgatgcttgaatctggccttttatttttcccatggcgtgattctttgt |
42242330 |
T |
 |
| Q |
198 |
tcctttgct |
206 |
Q |
| |
|
||||||||| |
|
|
| T |
42242329 |
tcctttgct |
42242321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University