View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15840_high_9 (Length: 357)
Name: NF15840_high_9
Description: NF15840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15840_high_9 |
 |  |
|
| [»] scaffold0190 (1 HSPs) |
 |  |  |
|
| [»] scaffold0425 (1 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0264 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0524 (1 HSPs) |
 |  |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 27)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 69 - 337
Target Start/End: Original strand, 4734482 - 4734759
Alignment:
| Q |
69 |
ttattatcttgatgggtctactgagtaatggccattttataattattccatataacattttaaatgtgtcctttgagatttaattatgaacccagaggtt |
168 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4734482 |
ttattatattgatgaatctaatgagtaatggccattttataattattccatataacattttaaatgtgtcccttgagatttaattatgaa-ccagaggtc |
4734580 |
T |
 |
| Q |
169 |
gcatgcaacgacaataatgaaccttacactttggaacaa----attcatacaaataagaaat----------aattatttttgcac-ttgtggtttgctg |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |||||| |||||| |
|
|
| T |
4734581 |
acatgcaacgacaataaggaaccttacactttggaacaagaggattcatacaaataagaaatctacattcaaaattattcttgcactttgtgg-ttgctg |
4734679 |
T |
 |
| Q |
254 |
taatataaaaaataagaaacaaatatgactgtaagggatggaatattttgtttaaaagataaacaagaaagttaaaaaagatac |
337 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4734680 |
taatataaaaaat----aataaatatgactgtaagggatgtaatattttgtttaaaagataaacaagaaagttaaaaaagatac |
4734759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 248 - 337
Target Start/End: Original strand, 4731763 - 4731852
Alignment:
| Q |
248 |
ttgctgtaatataaaaaataagaaacaaatatgactgtaagggatggaatattttgtttaaaagataaacaagaaagttaaaaaagatac |
337 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | ||||||||||| |||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
4731763 |
ttgctataatataaaaaataagaaacaaatattaatgtaagggatgaaatattttgtatttaagataaacaagaaagttaaaaaaaatac |
4731852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 16820972 - 16821034
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
16820972 |
ttatggtaataatttccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
16821034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 50619206 - 50619264
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
50619206 |
ttatggtaataattcccttttatggtatgcttaaccagtg-cccaggggcaccggttagc |
50619264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4089262 - 4089324
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
4089262 |
ttatggtaataattctcttttatggtatgtttaaccagtgccccaggggcaccagttagcagg |
4089324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 4268888 - 4268826
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| | |||||||||||||| |
|
|
| T |
4268888 |
ttatggtaataattcccttttatggtatgattaaccagtgccccgagggcaccggttagcagg |
4268826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 29591309 - 29591371
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||| || |||||||||||||| |
|
|
| T |
29591309 |
ttatggtaataattaccttttatggtatgcttaactagtgccccgggggcaccggttagcagg |
29591371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 43944627 - 43944686
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
43944627 |
ttatggtaataattcccttgtatggtatgcttaaccagtgcccgagg-gcaccggttagca |
43944686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 789596 - 789537
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
789596 |
ttatggtaataattcccttttatggtatgcttaaccagtagcccagaggcaccggttagc |
789537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 6164213 - 6164275
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc-aggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
6164213 |
ttatggtaataattctcttttatggtatgcttaaccagtaccccgagga-caccggttagcagg |
6164275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 16536168 - 16536230
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
16536168 |
ttatggtaataattctattttatggtattcttaaccagtgccccgggggcaccggttagcagg |
16536230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 33108739 - 33108677
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
33108739 |
ttatggtaataattcctttttatggtatgcttaacccgtgccccggaggcaccggttagcagg |
33108677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 36395219 - 36395261
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36395219 |
ttatgataataattcccttttatggtatgcttaaccagtgccc |
36395261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 18067945 - 18067885
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| || |||| || |||||||||||| |
|
|
| T |
18067945 |
ttatggtaataattcccttttatggtatgtttaacccgttccccgggggcaccggttagca |
18067885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 53004016 - 53003960
Alignment:
| Q |
7 |
taataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| ||| || |||||||||||||| |
|
|
| T |
53004016 |
taataattctcttttatgatatgcttaatcagtgtccccgggacaccggttagcagg |
53003960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 3783567 - 3783502
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgctta---accagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || |||||||| ||| ||||||||| |||| |
|
|
| T |
3783567 |
ttatggtaataattcccttttatggtatgcttaagtactagtgccccgggagcaccggttaacagg |
3783502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 32217164 - 32217207
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
32217164 |
ttatgataataattcccttttatggtatgcttaacctgtgcccc |
32217207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 5091676 - 5091616
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
5091676 |
ttatagtaataattcccttttatg-tatgcttaaccagtg-tccgggagcaccggttagcagg |
5091616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 7769058 - 7769120
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||| ||||||| || |||||||||||||| |
|
|
| T |
7769058 |
ttatggtaataattctcttttatggcatacttaacccgtgccccgggggcaccggttagcagg |
7769120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 12356364 - 12356426
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||| || || |||||||||||||| |
|
|
| T |
12356364 |
ttatgataataattctcttttatggtatgcttaaccagtgttccgggggcaccggttagcagg |
12356426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 43202449 - 43202407
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
43202449 |
ttatggtaataattctcttttatggtaagcttaaccagtgccc |
43202407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 50603348 - 50603410
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||| |||| || |||| ||||||||| |
|
|
| T |
50603348 |
ttatgataataattctcttttatggtatgcttaaccagtaccccgagaacaccagttagcagg |
50603410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 54897428 - 54897490
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |||||||||| ||| | |||||||||||||| |
|
|
| T |
54897428 |
ttatggtaataatttccttttatggtatgtttaaccagtgtcccggaggcaccggttagcagg |
54897490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30387200 - 30387167
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaa |
34 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
30387200 |
ttatggtaataattcctttttatgatatgcttaa |
30387167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 31517286 - 31517327
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
31517286 |
ttatggtaataattctcttatatggtatgcttaaccagtgcc |
31517327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 54054659 - 54054711
Alignment:
| Q |
11 |
aattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
54054659 |
aatttccttttatggtatgcttaaccagtgccccgggggcaccggttggcagg |
54054711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 54655936 - 54655881
Alignment:
| Q |
7 |
taataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
54655936 |
taataattctctcttatgatatgcttaaccagtgtccc-ggggcaccggttagcagg |
54655881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 4e-20; HSPs: 25)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 39074538 - 39074600
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39074538 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccaggggcaccggttagcagg |
39074600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 48725391 - 48725453
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
48725391 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggaccacgggttagcagg |
48725453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 10617350 - 10617288
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
10617350 |
ttatggtaataattcccttttatggtatgcttaacccgtgccccgggggcaccggttagcagg |
10617288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 33141005 - 33141065
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||| | | |||||||||||| |
|
|
| T |
33141005 |
ttatggtaataattcccttttatgatatgcttaatcagtaccccggaagcaccggttagca |
33141065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 42548215 - 42548274
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| || ||| |||||||||||| |
|
|
| T |
42548215 |
ttatggtaataattcccttttatggtatgcttaaccagtgctccggga-caccggttagca |
42548274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 49893451 - 49893510
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| || ||||||||||| |
|
|
| T |
49893451 |
ttatggtaataattcccttttatggtatgcttaatcagtgccccgggggcaccggttagc |
49893510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 272340 - 272402
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||| || |||||||||||||| |
|
|
| T |
272340 |
ttatggtaataattcccttttatggtatgcttaatcggtgccccgggggcaccggttagcagg |
272402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 6842739 - 6842801
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||| || || ||||||||||| |
|
|
| T |
6842739 |
ttatggtaataattcccatttatggtatgcttaaccagtgccccgggggcagcggttagcagg |
6842801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 42964315 - 42964253
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
42964315 |
ttatagtaataattcacttttatgatatgcttaaccagtgtctcagggacaccggttagcagg |
42964253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 43786991 - 43787053
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43786991 |
ttatggtaataattctattttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
43787053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 46352754 - 46352816
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
46352754 |
ttatggtaataattcccttttatggtatgcttaacccgtgccccggaggcaccggttagcagg |
46352816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 52520801 - 52520863
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
52520801 |
ttatggtaataattctattttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
52520863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 858709 - 858768
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||| || ||||||||||| |
|
|
| T |
858709 |
ttatggtaataatttccttttatggtatgcttaacccgtgccccgggggcaccggttagc |
858768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 40362646 - 40362603
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
40362646 |
ttatggtaataattctcttttatggtatgcttaaccagtgcccc |
40362603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 2505469 - 2505511
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
2505469 |
ttatggtaataattcccttttatggtatgtttaaccagtgccc |
2505511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4168303 - 4168365
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| || |||| || |||||||||||||| |
|
|
| T |
4168303 |
ttatggtaataattctcttttatggtatgcttaacccgtaccccgggggcaccggttagcagg |
4168365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 11308276 - 11308215
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
11308276 |
ttatggtaataattcc-ttttatggtatgcttaaccaatgccccaggggcaccgattagcagg |
11308215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 24488486 - 24488548
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| || ||| ||||||||| |||| |
|
|
| T |
24488486 |
ttatggtaataattctcttttatgatatgctgaactagtgctccgggagcaccggttaacagg |
24488548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 41304123 - 41304184
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |||||| | ||||||||||||| |
|
|
| T |
41304123 |
ttatggtaataatttccttttatggtatgcttaaccaatgccccggagacaccggttagcag |
41304184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 2938106 - 2938044
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||| |||| | |||||||||||||| |
|
|
| T |
2938106 |
ttatggtaataattcacttttatggtatgcttaacgagtaccccgagggcaccggttagcagg |
2938044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 7468531 - 7468591
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||| |||||||||| ||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
7468531 |
ttatgataataat-cccttttatggtatgcttaatcagtgcccc-ggagcaccggttagcagg |
7468591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 357
Target Start/End: Complemental strand, 46845536 - 46845507
Alignment:
| Q |
328 |
aaaaagatactacctccgtccctaattata |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46845536 |
aaaaagatactacctccgtccctaattata |
46845507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 49529332 - 49529291
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
49529332 |
ttatggtaataatttccttttatggtatgtttaaccagtgcc |
49529291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 22249006 - 22249066
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| | ||| || | |||||||||||| |
|
|
| T |
22249006 |
ttatggtaataattcccttttatagtatgcttgaccaataccctagaagcaccggttagca |
22249066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 28139429 - 28139469
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
28139429 |
ttatggtaataattcccttttatggtatacttaaacagtgc |
28139469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 34)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 51065814 - 51065752
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51065814 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccaggggcaccggttagcagg |
51065752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 19010753 - 19010695
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttag |
59 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
19010753 |
ttatggtaataattcccttttatggtatgattaaccagtgccccaggaacaccggttag |
19010695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 5694441 - 5694503
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| || || |||||||||||||| |
|
|
| T |
5694441 |
ttatggtaataattcccttttatggtatgcttaaccagtgctccgggggcaccggttagcagg |
5694503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 38162970 - 38163032
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
38162970 |
ttatggtaataattcccttttatggtatgcttaacccgtgccccgggggcaccggttagcagg |
38163032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 47010113 - 47010175
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47010113 |
ttatggtaataattctcttttatggtatgcttaaccagtgctccaggggcaccggttagcagg |
47010175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 50128238 - 50128176
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
50128238 |
ttatggtaataattctcttttatggtatgcttaaccagtgtcccagaaacaccggttagcagg |
50128176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 12072128 - 12072067
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
12072128 |
ttatggtaataattcctttttatggtatgcttaaccagtgccccgggggcaccggttagcag |
12072067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 15227859 - 15227919
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
15227859 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccggaggcaccggttagca |
15227919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 63
Target Start/End: Original strand, 29657894 - 29657953
Alignment:
| Q |
4 |
tggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| || |||||||||||||| |
|
|
| T |
29657894 |
tggtaataattcccttttatggtatgcttaaccagtgccctgggggcaccggttagcagg |
29657953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 9266794 - 9266732
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||| |||| | |||||||||||||| |
|
|
| T |
9266794 |
ttatggtaataattcgcttttatggtatacttaaccagtgctccagaagcaccggttagcagg |
9266732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 18043282 - 18043344
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
18043282 |
ttatggtaataattctattttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
18043344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 30294447 - 30294385
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| || || |||||||||||||| |
|
|
| T |
30294447 |
ttatggtaataattcccttttatggtatgcttaacctgtgctccggggacaccggttagcagg |
30294385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41730428 - 41730490
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||| | ||| |||||||||| |
|
|
| T |
41730428 |
ttatgataataattcccttttatggtatgcttaacaagtgccccagaagcactggttagcagg |
41730490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 45449310 - 45449248
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| |||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
45449310 |
ttatggtaataattgccttttatggtatgtttaaccagtgccccaggggcatcggttagcagg |
45449248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 48383177 - 48383115
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |||| ||| |||||||||| |
|
|
| T |
48383177 |
ttatggtaataattcccttttatggtatgcttaaccaatgcctcaggggcactggttagcagg |
48383115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42770056 - 42769995
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
42770056 |
ttatggtaataattctattttatggtatgcttaaccagtgccccgggggcaccggttagcag |
42769995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 45431398 - 45431443
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccag |
46 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
45431398 |
ttatggtaataattctcttttatgatatacttaaccagtgccccag |
45431443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 24178529 - 24178470
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
24178529 |
ttatggtaataatttcattttatggtatgcttaaccagtgccccgggggcaccggttagc |
24178470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 6770457 - 6770495
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagt |
39 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6770457 |
ttatgataataattcccttttatgatatgcttaaccagt |
6770495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 13961331 - 13961393
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
13961331 |
ttatggtaataattttcttttatggtatgcttaaccagtgctccaagggcaccggttagcagg |
13961393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 19031881 - 19031819
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||| | |||||||||||||| |
|
|
| T |
19031881 |
ttatggtaataatttccttttatgatatgcttaacccgtaccccggagacaccggttagcagg |
19031819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 52431700 - 52431761
Alignment:
| Q |
1 |
ttatggtaataattcccttttat-gatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||| |||||| | | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
52431700 |
ttatggtaataatttcctttttttggtatgcttaaccagtgccccagggacaccggttagca |
52431761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 12307037 - 12307077
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgc |
41 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
12307037 |
ttatggtaataattctcttttatggtatgcttaaccagtgc |
12307077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 3784779 - 3784720
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||| ||| || ||||||||||| |
|
|
| T |
3784779 |
ttatggtaataatttccttttatggtatgcttaacccgtgtcccgggggcaccggttagc |
3784720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 16 - 63
Target Start/End: Original strand, 29210529 - 29210576
Alignment:
| Q |
16 |
ccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29210529 |
ccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
29210576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 30657722 - 30657765
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
30657722 |
ttatgataataattcccttttatggtatgcttaaccagtacccc |
30657765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 3097779 - 3097817
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagt |
39 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3097779 |
ttatggtaataatttccttttatggtatgcttaaccagt |
3097817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 14350343 - 14350283
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14350343 |
ttatggtaataattccctta-atggtatgcttaaccagtgcccc-ggggcaccggttagcagg |
14350283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 35985687 - 35985641
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccagg |
47 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
35985687 |
ttatggtaataattcccatttatagtatacttaaccagtgccccagg |
35985641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 47532731 - 47532694
Alignment:
| Q |
7 |
taataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
47532731 |
taataattcccttttatggtatgcttaaccaatgcccc |
47532694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 51368851 - 51368810
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
51368851 |
ttatagtaataattccattttatggtatgcttaaccagtgcc |
51368810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 11797036 - 11796977
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||| | |||||| || ||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
11797036 |
ttatggtaataacttccttttttggtatccttaactagtgccccagga-caccggttagca |
11796977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 35
Target Start/End: Original strand, 26228300 - 26228332
Alignment:
| Q |
3 |
atggtaataattcccttttatgatatgcttaac |
35 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
26228300 |
atggtaataattcccttttatggtatgcttaac |
26228332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 28725971 - 28725911
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||| |||| |||||| | ||||||||||||||||||| || |||||||||||| |
|
|
| T |
28725971 |
ttatggtaagaatttccttttttcgtatgcttaaccagtgccccggggacaccggttagca |
28725911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 9e-18; HSPs: 27)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 9063118 - 9063056
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
9063118 |
ttatggtaataattcccttttgtgatatgcttaaccagtgccccggaagcaccggttagcagg |
9063056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 13643131 - 13643193
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13643131 |
ttatggtaataattctcttttatggtatgcttaaccagtgccctaggagcaccggttagcagg |
13643193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 13743556 - 13743618
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
13743556 |
ttatggtaataattctcttttatggtatgcttaaccagtgccctaggagcaccggttagcagg |
13743618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 34228802 - 34228864
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
34228802 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
34228864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 4537810 - 4537748
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4537810 |
ttatggtaataattcccttttatggtatgcttaacctgtgccccagaggcaccggttagcagg |
4537748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 3930293 - 3930237
Alignment:
| Q |
7 |
taataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
3930293 |
taataatttccttttatgatatgcttaaccagtgccccaggagcatcgattagcagg |
3930237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2805326 - 2805267
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||| |
|
|
| T |
2805326 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccggaggcaccggttagc |
2805267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 168586 - 168648
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |||||| || |||||||||||||| |
|
|
| T |
168586 |
ttatggtaataattccattttatggtatgcttaaccaatgccccgggggcaccggttagcagg |
168648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 27988565 - 27988523
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27988565 |
ttatggtaataattcccttttatggtatgcttaaccagtgccc |
27988523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 28045867 - 28045825
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28045867 |
ttatggtaataattcccttttatggtatgcttaaccagtgccc |
28045825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 30675638 - 30675577
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
30675638 |
ttatggtaataattcc-ttttatggtatgcttaaccagtgccccggggacaccggttagcagg |
30675577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 4648316 - 4648352
Alignment:
| Q |
3 |
atggtaataattcccttttatgatatgcttaaccagt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4648316 |
atggtaataattcccttttatgatatgcttaaccagt |
4648352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 42035047 - 42034988
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
42035047 |
ttatggtaataattcccttttatggtatgcttaacacgtgccccagagacaccggttagc |
42034988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 16394127 - 16394065
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||| |||||| || |||||||||||||| |
|
|
| T |
16394127 |
ttatgctaataattctcttttatggtatgcttaaccaatgccccgggggcaccggttagcagg |
16394065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 16888610 - 16888548
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||| || |||||||||||| |||||| || |||||||||||||| |
|
|
| T |
16888610 |
ttatggtaataattctcttttgtggtatgcttaaccaatgccccgggggcaccggttagcagg |
16888548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 16890546 - 16890484
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||| | || |||||||||||||| |
|
|
| T |
16890546 |
ttatggtaataattcctttttatggtatgcttaaccggtgcctccggggcaccggttagcagg |
16890484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 20831619 - 20831557
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||| || || |||||||||||||| |
|
|
| T |
20831619 |
ttatggtaataattctcttttatggtatgcttaatcagtgctcccgggacaccggttagcagg |
20831557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 9253968 - 9253907
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||| || |||||| ||||||||||||| |
|
|
| T |
9253968 |
ttatagtaataattctcttttatggtatgcttaaccaatgtcccaggggcaccggttagcag |
9253907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 21595966 - 21596005
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtg |
40 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
21595966 |
ttatggtattaattcccttttatggtatgcttaaccagtg |
21596005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 29444206 - 29444167
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtg |
40 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29444206 |
ttatggtaataattcccttttatggtatgtttaaccagtg |
29444167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 33357195 - 33357152
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
33357195 |
ttatggtaataattctcttttatggtatgcttaactagtgcccc |
33357152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 39406962 - 39407022
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||||||||||| |||| ||||| |||||||| || |||||||||||||| |
|
|
| T |
39406962 |
ttatgataataattcccttttatggtatgtttaactagtgccccggg--caccggttagcagg |
39407022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 9537890 - 9537828
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
9537890 |
ttatagtaataatttccttttatggtatgcttaaccagtgtcccggagacaccggttagcagg |
9537828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 28626888 - 28626949
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| ||||| || ||| |||||||||||||| |
|
|
| T |
28626888 |
ttatgataataattcccttttatggtatgcttaatcagtg-tccgggagcaccggttagcagg |
28626949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 32114029 - 32114091
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
32114029 |
ttatgataataattcccttttatagtatgtttaaccagtgctccagagccaccggttagcagg |
32114091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 29235355 - 29235415
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||| ||| ||| |||||||||||| |
|
|
| T |
29235355 |
ttatgataataatttccttttataggatgcttaaccagtgtcccgggaacaccggttagca |
29235415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 325 - 357
Target Start/End: Original strand, 44580606 - 44580638
Alignment:
| Q |
325 |
ttaaaaaagatactacctccgtccctaattata |
357 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
44580606 |
ttaaaagagatactacctccgtccctaattata |
44580638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 9e-18; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 24438597 - 24438659
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
24438597 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
24438659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4628686 - 4628748
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
4628686 |
ttatggtaataattcccttttatggtatgcttaaccagtgccttaggggcaccggttagcagg |
4628748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 34606381 - 34606443
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
34606381 |
ttatggtaataattaccttttatggtatgcttaacccgtgccccgggagcaccggttagcagg |
34606443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 13064942 - 13064881
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
13064942 |
ttatggtaataattcccttttatggtatgcttaaccagtgctctaggggcaccggttagcag |
13064881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 12218502 - 12218441
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
12218502 |
ttatggtaataattctcttttatggtatgtttaaccagtgccccggga-caccggttagcagg |
12218441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 24798469 - 24798407
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
24798469 |
ttatggtaataattcccttttatagtatgcttaaccagtgccccgggggcaccagttagcagg |
24798407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 42044359 - 42044300
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| || |||||||||||| |
|
|
| T |
42044359 |
ttatggtaataattcccttttatggtatgtttaaccagtgcccc-ggggcaccggttagca |
42044300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 29993553 - 29993514
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtg |
40 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29993553 |
ttatggtaataattcccttttatggtatgcttaaccagtg |
29993514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 45045890 - 45045933
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45045890 |
ttatgataataattcccttttatggtatgcttaaccagtgcccc |
45045933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 525141 - 525080
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| | || ||| |||||||||||||| |
|
|
| T |
525141 |
ttatggtaataattctcttttatgatatgtttaaccagtactcc-ggagcaccggttagcagg |
525080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 5239405 - 5239467
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || ||| |||||||||| |
|
|
| T |
5239405 |
ttatggtaataattcccttttatggtatgcttaacttgtgcccccggggcactggttagcagg |
5239467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 28588029 - 28588091
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||| | |||| ||| || ||||||||||| |
|
|
| T |
28588029 |
ttatggtaataattcccttttatggtatgtttaaccaataccccgggaacatcggttagcagg |
28588091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 34333403 - 34333465
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| |||| |||||| ||||||| || |||||||||||||| |
|
|
| T |
34333403 |
ttatggtaataattcctttttatggtatgtttaacccgtgccccgggggcaccggttagcagg |
34333465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 47657098 - 47657139
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
47657098 |
ttatggtaataattcccttttatggtatgcttaatcagtgcc |
47657139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 47083175 - 47083211
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaacca |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47083175 |
ttatggtaataattcccttttatgatatgtttaacca |
47083211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 11686388 - 11686353
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaacc |
36 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11686388 |
ttatggtaataattctcttttatgatatgcttaacc |
11686353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 23357776 - 23357733
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
23357776 |
ttatgataataattctcttctatgatatgcttaaccagtgcccc |
23357733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 47839612 - 47839655
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
47839612 |
ttatggtaataattcccttttatggtatgaataaccagtgcccc |
47839655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 7689266 - 7689224
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
7689266 |
ttatggtaataattctcttttatggtatacttaaccagtgccc |
7689224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1737100 - 1737160
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
1737100 |
ttatgataataattca-ttttatggtatgcttaaccagtgccccggaagcaccggttagcag |
1737160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 33636572 - 33636613
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
33636572 |
ttatggtaataattctattttatggtatgcttaaccagtgcc |
33636613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 18486081 - 18486144
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc-aggatcaccggttagcaggg |
64 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||| ||||||| | || ||||||||||||||| |
|
|
| T |
18486081 |
ttatggtaataatttcattttatggtatgcttaacccgtgccccgaaga-caccggttagcaggg |
18486144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 9e-18; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 12525839 - 12525901
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
12525839 |
ttatggtaataattcccttttatgatatgcttaactagtgccccagggataccggttagcagg |
12525901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 32929574 - 32929512
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
32929574 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
32929512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 392216 - 392278
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
392216 |
ttatggtaataattctcttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
392278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 1391244 - 1391182
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
1391244 |
ttatgataataattcccttttatggtatgcttaaccagtgttccaggaacaccggttagcagg |
1391182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 1840311 - 1840253
Alignment:
| Q |
3 |
atggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || | |||||||||||| |
|
|
| T |
1840311 |
atggtaataattcccttttatgatatgtttaaccagtgccctagaaacaccggttagca |
1840253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 2581072 - 2581134
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | |||| ||| |||||||||||||| |
|
|
| T |
2581072 |
ttatggtaataattcccttttatggtatgcttaaccaataccccgggagcaccggttagcagg |
2581134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 3515886 - 3515948
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
3515886 |
ttatggtaataattcccttttatggtatgtttaacctgtgccccaggggcaccggttagcagg |
3515948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 11115163 - 11115106
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttag |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
11115163 |
ttatggtaataattcccttttatgatatgtttaaccagtgccccggga-caccggttag |
11115106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 29978352 - 29978413
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||| ||| |||||||||||||| |
|
|
| T |
29978352 |
ttatggtaataattcccttttatgatatgcttaaccagcg-ccctggaacaccggttagcagg |
29978413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 32985259 - 32985198
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
32985259 |
ttatgataataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcag |
32985198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 2350772 - 2350832
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||| |
|
|
| T |
2350772 |
ttatggtaataattcccttttatgatatgcttaaccagtaccccggagacaccggttagca |
2350832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4215815 - 4215877
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| || || ||||||||||| |
|
|
| T |
4215815 |
ttatggtaataatttccttttatggtatgcttaaccagtgccccgggggcatcggttagcagg |
4215877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35044009 - 35044052
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35044009 |
ttatggtaataattctcttttatggtatgcttaaccagtgcccc |
35044052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 13417025 - 13416983
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13417025 |
ttatggtaataattctcttttataatatgcttaaccagtgccc |
13416983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 23402258 - 23402320
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
23402258 |
ttatggtaataattaccttttatggtatgcttaacccgtgccccggaggcaccggttagcagg |
23402320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 25165479 - 25165417
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| ||||||||| |||||| |||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
25165479 |
ttatgataataattctcttttacgatatgcttaaccaatgccctgggagcaccggttagcagg |
25165417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 7851225 - 7851165
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| || |||||||||||| |
|
|
| T |
7851225 |
ttatggtaataattcccttttatggtatgcttaactcgtgccctagagacaccggttagca |
7851165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 26467190 - 26467130
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| | |||||||||||| |
|
|
| T |
26467190 |
ttatggtaataattcccttttatggtatgtctaaccagtgccccggaggcaccggttagca |
26467130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 27433612 - 27433672
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| || |||| || |||||||||||| |
|
|
| T |
27433612 |
ttatggtaataattcccttttatggtatgtttaacccgttccccgggggcaccggttagca |
27433672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 18276681 - 18276616
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatat---gcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
18276681 |
ttatggtaataatttccttttatggtattatgcttaaccagtgcccctggggcaccggttagcagg |
18276616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29451181 - 29451138
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
29451181 |
ttatgataataattcccttttatggtatgcttaacccgtgcccc |
29451138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 5323520 - 5323562
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
5323520 |
ttatggtaataattcccttttatggtatgcgtaaccggtgccc |
5323562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 21878394 - 21878357
Alignment:
| Q |
26 |
tatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
21878394 |
tatgtttaaccagtgccccaggaacaccggttagcagg |
21878357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 34706841 - 34706901
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||| |||| |||||| | ||||||||||||||||||| || |||||||||||| |
|
|
| T |
34706841 |
ttatggtaagaatttccttttttcgtatgcttaaccagtgccccgggggcaccggttagca |
34706901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 9e-18; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 11958033 - 11957971
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11958033 |
ttatggtaataattcccttttatggcatgcttaaccagtgccccaggggcaccggttagcagg |
11957971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 34650899 - 34650837
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
34650899 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
34650837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 35132641 - 35132703
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||| || |||||||||||||| |
|
|
| T |
35132641 |
ttatggtaataattctcttttatggtatgcttaaccaatgccccgggggcaccggttagcagg |
35132703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 6283682 - 6283742
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
6283682 |
ttatggtaataattcatttttatggtatgcttaaccagtgccctaggggcaccggttagca |
6283742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 10956071 - 10956114
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
10956071 |
ttatggtaataatttccttttatgatatgcttaaccagtacccc |
10956114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 8787459 - 8787521
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
8787459 |
ttatgataataattccattttatggtatgcttaacctgtgccccgggggcaccggttagcagg |
8787521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 13661928 - 13661990
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
13661928 |
ttatggtaataattctcttttatggtatgcttaacccgtgccccggaggcaccggttagcagg |
13661990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 40564470 - 40564408
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| | ||||| | |||||||||||||| |
|
|
| T |
40564470 |
ttatggtaataattctcttttatggtatgcttaaccaataccccaagggcaccggttagcagg |
40564408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 12506416 - 12506464
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggat |
49 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12506416 |
ttatagtaataattctcttttatggaatgcttaaccagtgccccaggat |
12506464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 31467840 - 31467900
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||| |||| |||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
31467840 |
ttatggtaagaatttcctttttttgtatgcttaaccagtgccccagggacaccggttagca |
31467900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 44
Target Start/End: Complemental strand, 10956009 - 10955974
Alignment:
| Q |
9 |
ataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10956009 |
ataattcccttttatggtatgcttaaccagtgcccc |
10955974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 11846192 - 11846235
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
11846192 |
ttatggtaataaatcccttttatagtatgcttaaccagtgcccc |
11846235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 39
Target Start/End: Complemental strand, 2619630 - 2619596
Alignment:
| Q |
5 |
ggtaataattcccttttatgatatgcttaaccagt |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
2619630 |
ggtaataattcccttttatgatatgcttaatcagt |
2619596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 10054419 - 10054357
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| |||| |||||| ||||||| || ||||||||||||| |
|
|
| T |
10054419 |
ttatggtaataattcctttttatggtatgtttaacccgtgccccgggggtaccggttagcagg |
10054357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 10070086 - 10070131
Alignment:
| Q |
18 |
ttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||| |||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
10070086 |
ttttatggtatgcttaaccaatgtcccaggagcaccggttagcagg |
10070131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 20175347 - 20175387
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgc |
41 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
20175347 |
ttatgataataattcccttttataatatgcttaactagtgc |
20175387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 9e-18; HSPs: 23)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 20553051 - 20553113
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
20553051 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
20553113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 30486330 - 30486392
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
30486330 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccggttagcagg |
30486392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 1859282 - 1859342
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
1859282 |
ttatggtaataattctcttttatggtatgcttaaccagtgccctaggaacaccggttagca |
1859342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 4381915 - 4381977
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
4381915 |
ttatggtaataattccattttatggtatgcttaaccagtgccccgggagcactggttagcagg |
4381977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 22068386 - 22068324
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
22068386 |
ttatggtaataattcccttttatggtatgcttaaccagtgccccgggggcaccgattagcagg |
22068324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 31438766 - 31438828
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
31438766 |
ttatgataataattcccttttatggtatgcttaaccagtgccccggggacaccggttagcagg |
31438828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 32360935 - 32360873
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||| || |||||||||||||| |
|
|
| T |
32360935 |
ttatggtaataattcccttttatggtatgcttaaccaatgccccgggggcaccggttagcagg |
32360873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 6580309 - 6580352
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6580309 |
ttatggtaataattcccttttatggtatgcttaaccagtgcccc |
6580352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 22567722 - 22567784
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
22567722 |
ttatggtaataattctcttttatggtatgcttaacccgtgctccaggggcaccggttagcagg |
22567784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 27856462 - 27856400
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| || || ||||||||||| |
|
|
| T |
27856462 |
ttatggtaataatttccttttatggtatgcttaaccagtgccccgggggcatcggttagcagg |
27856400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 28601086 - 28601148
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
28601086 |
ttatggtaataattctcttttatggtatgcttaaccagtgcactgggagcaccggttagcagg |
28601148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 34442598 - 34442556
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccc |
43 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34442598 |
ttatggtaataattcccttttatggtatgcttaaccagtgccc |
34442556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 44588022 - 44588084
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| || ||||||||||||| |
|
|
| T |
44588022 |
ttatggtaataattcccttttatggtatgcttaacaagtgccccgggggtaccggttagcagg |
44588084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 26387130 - 26387089
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26387130 |
ttatggtaataattcccttttatggtatgcttaaccagtgcc |
26387089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 4022545 - 4022483
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||||||| ||| || |||||||||||||| |
|
|
| T |
4022545 |
ttatgataataatttccttttatgatatgtttaaccagtgtcccgggggcaccggttagcagg |
4022483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 13574095 - 13574034
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| |||||| | || |||||||||||||| |
|
|
| T |
13574095 |
ttatggtaataatttccttttatggtatgcttaacccgtgccctaaga-caccggttagcagg |
13574034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 31390132 - 31390194
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| || || ||||| |||||||| |
|
|
| T |
31390132 |
ttatggtaataattcccttttatggtatgcttaacccgtgctccgggggcaccgattagcagg |
31390194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 8969473 - 8969412
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||||| || ||||||||||||| |
|
|
| T |
8969473 |
ttatggtaataatttccttttatagtatgcttaactagtgcccctggggcaccggttagcag |
8969412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 22887870 - 22887910
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgc |
41 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
22887870 |
ttatggtaataattctcttttatggtatgcttaaccagtgc |
22887910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 38590940 - 38590904
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaacca |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38590940 |
ttatggtaataattcccttttatggtatgcttaacca |
38590904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 25782899 - 25782860
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtg |
40 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
25782899 |
ttatgataataattcccttttatggtatgcttaaccagtg |
25782860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 35851817 - 35851776
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcc |
42 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
35851817 |
ttatggtaataattctcttttatggtatgcttaaccaatgcc |
35851776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 3668179 - 3668119
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||| |||||||| |||| |||||||||||||| | |||||||||||| |
|
|
| T |
3668179 |
ttatggtaataatttccttttatagtatgtttaaccagtgccccgagggcaccggttagca |
3668119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 15016 - 15059
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15016 |
ttatggtaataattcccttttatggtatgcttaaccagtgcccc |
15059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0425 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 10830 - 10892
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| | || || ||||||||||| |
|
|
| T |
10830 |
ttatggtaataattcccatttatggtatgcttaaccagtgcctcgggggcagcggttagcagg |
10892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 6176 - 6114
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||||||| |||||||||| |||| |||||| ||||||| || |||||||||||||| |
|
|
| T |
6176 |
ttatggtaataatccccttttatggtatgtttaacccgtgccccgggggcaccggttagcagg |
6114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 116324 - 116385
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcag |
62 |
Q |
| |
|
||||| |||||||||||||||||| |||| |||||| |||||||||| |||||||||||| |
|
|
| T |
116324 |
ttatgataataattcccttttatggtatgtttaacccgtgccccagggataccggttagcag |
116385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0264 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0264
Description:
Target: scaffold0264; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 23081 - 23141
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
||||| ||||||||| |||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
23081 |
ttatgttaataattctcttttatggtatgtttaaccagtgccccaaggacaccggttagca |
23141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 53751 - 53691
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagca |
61 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| || |||| || |||||||||||| |
|
|
| T |
53751 |
ttatggtaataattcccttttatggtatgtttaacccgttccccgggggcaccggttagca |
53691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0524 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0524
Description:
Target: scaffold0524; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 945 - 1004
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagc |
60 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||||| | | ||||||||||| |
|
|
| T |
945 |
ttatagtaataattctcttttatggtatgcttaaccagtgccctaaggacaccggttagc |
1004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 41039 - 41078
Alignment:
| Q |
1 |
ttatggtaataattcccttttatgatatgcttaaccagtg |
40 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
41039 |
ttatgataataatttccttttatgatatgcttaaccagtg |
41078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 68352 - 68313
Alignment:
| Q |
5 |
ggtaataattcccttttatgatatgcttaaccagtgcccc |
44 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
68352 |
ggtaataattcccttttatggtatgcttaaccagtacccc |
68313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 63
Target Start/End: Complemental strand, 53417 - 53361
Alignment:
| Q |
7 |
taataattcccttttatgatatgcttaaccagtgccccaggatcaccggttagcagg |
63 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||| | |||||||||||||| |
|
|
| T |
53417 |
taataattctcttttatggtatgcttaactagtgccccggaggcaccggttagcagg |
53361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University