View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15841_high_2 (Length: 263)

Name: NF15841_high_2
Description: NF15841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15841_high_2
NF15841_high_2
[»] chr3 (1 HSPs)
chr3 (1-248)||(30903408-30903658)


Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 30903408 - 30903658
Alignment:
1 gcttgatatagtatatcttttagatgaatggcggggcttggtcaaaaacaaacttgtaatatcttct---cttgtctaccacttggacannnnnnnnncc 97  Q
    |||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||   |||||||||  ||||||           ||    
30903408 gcttcatatagtatatcttctagatgaatggcggcgcttggtcaaaaacaaacttgtactatcttcttatcttgtctacggcttggaattttttttttcc 30903507  T
98 aactatagtacatctttacttacaactttttatttctcgtcaaccccttcgaactcccattttcaatactaaaccttacccttcgcaaatagcttaactc 197  Q
    ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||  ||||||| || |||||||  || ||||||||||||||||||||    
30903508 aactatagtacatctttacttacaattttttatttcttgtcaaccccttcgaactttcattttctatgctaaaccccactcttcgcaaatagcttaactc 30903607  T
198 ggtttcacgctttcgcataaaaattacatattgcacgcggtggcagtttct 248  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||||||    
30903608 ggtttcacgctttcacataaaaattacatattgcatgcggtggcagtttct 30903658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University