View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15841_low_3 (Length: 263)
Name: NF15841_low_3
Description: NF15841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15841_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 30903408 - 30903658
Alignment:
| Q |
1 |
gcttgatatagtatatcttttagatgaatggcggggcttggtcaaaaacaaacttgtaatatcttct---cttgtctaccacttggacannnnnnnnncc |
97 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||| |||||| || |
|
|
| T |
30903408 |
gcttcatatagtatatcttctagatgaatggcggcgcttggtcaaaaacaaacttgtactatcttcttatcttgtctacggcttggaattttttttttcc |
30903507 |
T |
|
| Q |
98 |
aactatagtacatctttacttacaactttttatttctcgtcaaccccttcgaactcccattttcaatactaaaccttacccttcgcaaatagcttaactc |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||| || ||||||| || |||||||||||||||||||| |
|
|
| T |
30903508 |
aactatagtacatctttacttacaattttttatttcttgtcaaccccttcgaactttcattttctatgctaaaccccactcttcgcaaatagcttaactc |
30903607 |
T |
|
| Q |
198 |
ggtttcacgctttcgcataaaaattacatattgcacgcggtggcagtttct |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30903608 |
ggtttcacgctttcacataaaaattacatattgcatgcggtggcagtttct |
30903658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University