View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15842_high_12 (Length: 221)

Name: NF15842_high_12
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15842_high_12
NF15842_high_12
[»] chr8 (1 HSPs)
chr8 (17-203)||(16690662-16690848)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 16690848 - 16690662
Alignment:
17 ttattctaagtatgatttttgtttttcaaacttgttagctttcaagagattgtccctttgaatgctggaaatgtgcttgtattagaggacaatgaacctg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16690848 ttattctaagtatgatttttgtttttcaaacttgttagctttcaagagattgtccctttgaatgctggaaatgtgcttgtattagaggacaatgaacctg 16690749  T
117 ctgcgaaatggcttgccttaatcaatcaatcactcaatggtccttcagatttctcttctaataaagggctaaaacctactgcatcat 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
16690748 ctgcgaaatggcttgccttaatcaatcaatcactcaatggtccttcagatttctcttcaaataaagggctaaaacccactgcatcat 16690662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University