View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_12 (Length: 297)
Name: NF15842_low_12
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 26879322 - 26879060
Alignment:
| Q |
18 |
catggagcaggttagaacatcaatttttcaggctgtgtctgattggtattgttagcgtggttagggaaagtattaaggtgtcgcagaactattgtattat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879322 |
catggagcaggttagaacatcaatttttcgggctgtgtctgattggtattgttagcgtggttagggaaagtattaaggtgtcgcagaactattgtattat |
26879223 |
T |
|
| Q |
118 |
ggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttctt-aaaaccacacatgttttcggaagtgcacttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26879222 |
ggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttcttaaaaaccacacgtgttttcggaagtgcacttct |
26879123 |
T |
|
| Q |
217 |
aggtggat-nnnnnnnccatgnnnnnnnngtctggaaggacatatgtagacgacataaaaact |
278 |
Q |
| |
|
||| |||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26879122 |
aggcggataaaaaaaaccatgttttttttgtctggaaggacatatgtagacgacataaaaact |
26879060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 100 - 140
Target Start/End: Complemental strand, 40247225 - 40247185
Alignment:
| Q |
100 |
gcagaactattgtattatggatctttgcccctttgaaatac |
140 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
40247225 |
gcagaactagtgtattatggctctttgcccctttgaaatac |
40247185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 80
Target Start/End: Complemental strand, 40248798 - 40248742
Alignment:
| Q |
24 |
gcaggttagaacatcaatttttcaggctgtgtctgattggtattgttagcgtggtta |
80 |
Q |
| |
|
|||||||||| |||| | ||| ||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
40248798 |
gcaggttagagcatctaatttccagactgtgtttgattggtattgttagtgtggtta |
40248742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University