View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_13 (Length: 274)
Name: NF15842_low_13
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 16963701 - 16963944
Alignment:
| Q |
16 |
gtttcataaattgcttgtagtagctcagaacttttatgatgtagctgtactttgttcaggtggctgcagaaaagaagcactgaaatggcaaaaatgataa |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16963701 |
gtttcatgaattgcttgtagtagctcagaacttttatgatgtagctgtactttgttcaggtggctgcagaaaagaagcactgaaatggcaaaaatgataa |
16963800 |
T |
|
| Q |
116 |
taaagagaggagatgaaatttgaacacaagaaattgatgtaaatggaattgtgttggaagaggtgtttgctcaaagtgtaatgttaaggaaaagcattca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16963801 |
taaagagaggagatgaaatttgaacacaagaaattgatgtaaatggaattgtgttggaagaggtgtttgctcaaagtgtaatgttaaggaaaagcattca |
16963900 |
T |
|
| Q |
216 |
atgcttctcagaagaaaaattgtagcattgctctccatttcaat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16963901 |
atgcttctcagaagaaaaattgtagcattgctctccatttcaat |
16963944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University