View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_18 (Length: 251)
Name: NF15842_low_18
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 21 - 122
Target Start/End: Original strand, 21075581 - 21075682
Alignment:
| Q |
21 |
taaggcatcagatgttcacctaaaaattgcggaatccagcctcaatcaaggggcagtttgattacagcaactgatattgacaatggagtacaatgtagat |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21075581 |
taaggcatcaaatgttcacctaaaaattgcggaatccggcctcaatcaaggggcagtttgattacagcaactgatattgacaatggagtacaatgtagat |
21075680 |
T |
 |
| Q |
121 |
ta |
122 |
Q |
| |
|
|| |
|
|
| T |
21075681 |
ta |
21075682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 109 - 235
Target Start/End: Original strand, 21075696 - 21075829
Alignment:
| Q |
109 |
tacaatgtagattaagtcctcaactacttgcaa------catgactgcaagccacaaattacaatatacatataagcctgcaacca-tttttccttagct |
201 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
21075696 |
tacaatgtcgattaagtcctcaaatacttgcaagtgcaacatggctgcaagccacaaattacaatataaatataagcctgcaaccattttttccttagct |
21075795 |
T |
 |
| Q |
202 |
ctttttgttttctcatttttcctcaactgaaatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21075796 |
ctttttgttttctcatttttcctcaactgaaatt |
21075829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University