View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_19 (Length: 251)
Name: NF15842_low_19
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 6020043 - 6019827
Alignment:
| Q |
16 |
aaactcaattaaagacaaaattgtgcatgactatctgacggatgacacgctgtaagcatatcttaagtgtgatcaactatagcaacgcaatatcaatcgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6020043 |
aaactcaattaaagacaaaattgtgcatgactatctgacggatgacacactgtaagcatatcttaagtgtgatcaactatagcaacgcaatatcaatcgg |
6019944 |
T |
|
| Q |
116 |
gcagtgcaaccaatgcattatctaccgcaatctaatcgacagacaacctctgattggtagcaacgcaatatcaacccagcagtgatatcaacacattctc |
215 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6019943 |
gcagtgcaaccaaagctttatctaccgcaatctaatcgacagacaacctctgattggtagcaacgcaatatcaacccagcagtgatatcaacacattctc |
6019844 |
T |
|
| Q |
216 |
taccaccatctaatcag |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6019843 |
taccaccatctaatcag |
6019827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University