View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_20 (Length: 239)
Name: NF15842_low_20
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41863397 - 41863620
Alignment:
| Q |
1 |
tattagggatgtctacatatatatgattctcatctctgccaaatttttagaagttcctgaacgaaattaatttggtatatattcattcagtgggcaaaaa |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41863397 |
tattagggatgtctatatatatatgattctcatctctgccaaatttttagaagttcctgaacgaaattaatttggtatatattcattcagtggacaaaaa |
41863496 |
T |
 |
| Q |
101 |
tgataaaaaggtgataacactgtagaataaaatagcaaagatattgccatatttttcaacccac-aaaaaaggaagcagattccaaatttgttaattgat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863497 |
tgataaaaaggtgataacactgtagaataaaatagcaaagatattgccatatttttcaacccacaaaaaaaggaagcagattccaaatttgttaattgat |
41863596 |
T |
 |
| Q |
200 |
tgatgatgtaacggttaatcaatc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41863597 |
tgatgatgtaacggttaatcaatc |
41863620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University