View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_22 (Length: 237)
Name: NF15842_low_22
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 150
Target Start/End: Complemental strand, 598451 - 598338
Alignment:
| Q |
38 |
aatagagatagagattaaa-aatataagtcggtgcaatgtaatttcggaaatactcatgatatgcggtttcacgatattatgcatttttgtttatttaaa |
136 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
598451 |
aataaagatagagattaaagaatataagtcggtgcaatgtaatttttgaaatactcatgatgtgcggtttcacgatattatgcatttttgtttatttaaa |
598352 |
T |
 |
| Q |
137 |
tacggatagtttat |
150 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
598351 |
tacgggtagtttat |
598338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 598046 - 597978
Alignment:
| Q |
134 |
aaatacggatagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
598046 |
aaatacggatagtttatttaaatctttatactgagtggttgtttatggacacttatttaaatctttata |
597978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 17374585 - 17374497
Alignment:
| Q |
133 |
taaatacggatagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttatattgagaaaaacttgaaacc |
221 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17374585 |
taaatacaggtagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttatattgagaaaaacttgaaacc |
17374497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University