View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_24 (Length: 214)
Name: NF15842_low_24
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 31655977 - 31655800
Alignment:
| Q |
19 |
atgcaaaataacaacggatacaggggggtttccttcctcaccccctcttgtaaggaaaatatcctctttgcttgttacaaataagcaaaatcgagtactg |
118 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31655977 |
atgcaaaatagcaacggataaaggggg-tttccttcctcaccccctcttgcaaggaaaatatcctctttgcttgttacaaataagcaaaatcgagaactg |
31655879 |
T |
 |
| Q |
119 |
catttatccaacgacaaaacttgttgctgaagccaaatgaatttagcaccttcagaagaaactttcggttaagaatgtc |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
31655878 |
catttatccaccgacaaaacttgttgctgaagccaaatgaatttagcaccttcagaagaaacttccggttaagagtgtc |
31655800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University