View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15842_low_8 (Length: 349)
Name: NF15842_low_8
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15842_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 138 - 336
Target Start/End: Original strand, 48401753 - 48401951
Alignment:
| Q |
138 |
cgacactaactgcagctgaattaatatttgaattttggggcggaaatgagctgttttgaaaaatagaggagcaatttttcaacaaatcacaatggggctt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48401753 |
cgacactaactgcagctgaattaatatttgaattttggggcggaaatgagctgttttgaaaaatagaggagcaatttttcaacaaatcacaatggggctt |
48401852 |
T |
 |
| Q |
238 |
ataaatgtaattaaagaattttcagttcccttccacacatgtcaccacacttttgagttgattaaaaatattagcgtgtaattaatttaaacgtgaaac |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48401853 |
ataaatgtaattaaagaattttcagttcccttccacacatgtcaccacacttttgagttgattaaaaatattagcgtgtaattaatttaaacatgaaac |
48401951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 48401642 - 48401693
Alignment:
| Q |
1 |
agcgaaaaaagaaatgatctcaaagtat-cacggtactaaattgccgttggg |
51 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48401642 |
agcgaaaaaagaaatgatctcaaagtatccacggtactaaattgccgttggg |
48401693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 77 - 117
Target Start/End: Original strand, 48401719 - 48401759
Alignment:
| Q |
77 |
cttaaatactttactttaattgtcgttggagcagcgacact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48401719 |
cttaaatactttactttaattgtcgttggagcagcgacact |
48401759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University