View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15843_high_3 (Length: 266)
Name: NF15843_high_3
Description: NF15843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15843_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 50532291 - 50532368
Alignment:
| Q |
12 |
ttatactaggtttgattttggctttgacaatatgttgtgtggtttatttggaagttccataacgaatttatcttaaag |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50532291 |
ttatactaggtttgattttggctttgacaatatgttgtgtggtttatttggaagttccataatgaatttatcttaaag |
50532368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 50532367 - 50532419
Alignment:
| Q |
197 |
agtagaacatgttctctgttgatcttgtctcgttcttatttttggttgtttct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532367 |
agtagaacatgttctctgttgatcttgtctcgttcttatttttggttgtttct |
50532419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University