View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15843_low_5 (Length: 266)

Name: NF15843_low_5
Description: NF15843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15843_low_5
NF15843_low_5
[»] chr4 (2 HSPs)
chr4 (12-89)||(50532291-50532368)
chr4 (197-249)||(50532367-50532419)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 50532291 - 50532368
Alignment:
12 ttatactaggtttgattttggctttgacaatatgttgtgtggtttatttggaagttccataacgaatttatcttaaag 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
50532291 ttatactaggtttgattttggctttgacaatatgttgtgtggtttatttggaagttccataatgaatttatcttaaag 50532368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 50532367 - 50532419
Alignment:
197 agtagaacatgttctctgttgatcttgtctcgttcttatttttggttgtttct 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
50532367 agtagaacatgttctctgttgatcttgtctcgttcttatttttggttgtttct 50532419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University