View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15843_low_7 (Length: 226)
Name: NF15843_low_7
Description: NF15843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15843_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 21593579 - 21593385
Alignment:
| Q |
18 |
cagctcctgatgacttttccctttgttagctttagactctttctacttgagttttaattccctaccagcttcataaaaatcaacaacttcagccattacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
21593579 |
cagctcctgatgacttttccctttgttagctttagactctttctacttgagctttaattccctaccggcttcataaaaatcaacaacttcagtcattacc |
21593480 |
T |
 |
| Q |
118 |
cagaagtatactagatttgtatacgcatgatcattcaacatttcaaaataagacaaccaaccctgatgttcgaaagcactcttgacatcgcaccc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21593479 |
cagaagtatactagatttgtatacgcatgatcattgaacatttcaaaataagacaaccaaccctgatgttcgaaagcactcttgatatcgcaccc |
21593385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University