View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15844_low_7 (Length: 204)
Name: NF15844_low_7
Description: NF15844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15844_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 31 - 204
Target Start/End: Original strand, 34899398 - 34899571
Alignment:
| Q |
31 |
ccctcttgctttgccacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
130 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899398 |
cccttttgttttgacacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
34899497 |
T |
 |
| Q |
131 |
aatttttgacttcttcaacnnnnnnnntctatgaagaagtgtctgctaagacttacaaataattagttggtagc |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899498 |
aatttttgacttcttcaacaaaaaaaatctatgaagaagtgtctgctaagacttacaaataattagttggtagc |
34899571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University