View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15845_high_10 (Length: 319)
Name: NF15845_high_10
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15845_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 23 - 309
Target Start/End: Original strand, 41468106 - 41468392
Alignment:
| Q |
23 |
gtggagatgtgtctgaacgatgaaactggatgtggtctggaagatgagagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaagttgaga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468106 |
gtggagatgtgtctgaacgatgaaactggatgtggtctggaagatgagagtgagagtaacgagtccaaccaagttcagtgagtcgttgctcaagttgaga |
41468205 |
T |
 |
| Q |
123 |
gaaggaatgaatgacttggtttgttggaagatatacaagaattcttggtcttgcacctggtgctgttgctgttcctgttcctggttctgtcttgtgctca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468206 |
gaaggaatgaatgacttggtttgttggaagatatacaagaactcttggtcttgcacctggtgctgttgctgttcctgttcctggttctgtcttgtgctcg |
41468305 |
T |
 |
| Q |
223 |
aaggattctcttgttgggttggttattaacctcaccacacctttcttgtcaaatacccatacacctgacattacttgctttcctttg |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41468306 |
aaggattctcttgttgggttggttattaacctcaccacacctttcttgtcaaatacccatacacctgacattacttgctttcctttg |
41468392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University