View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15845_high_12 (Length: 243)
Name: NF15845_high_12
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15845_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 21189196 - 21188987
Alignment:
| Q |
10 |
gtagcataggaataaaacacccttctatacatgtgagctaagtatattgttccaacccaatgttttagattatgctgtccatttcggtgcattgattttc |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21189196 |
gtagcaaaggaataaaacacccttctatacatgtgagctaagtatattgttccaacccaatgttttagattttgctgtccatttcggtgcattgattttc |
21189097 |
T |
 |
| Q |
110 |
tagatctttatgagnnnnnnnnttaaatttttatatgtttgggatttcgaaaatcaatttgctagtataattgagtgcccaaatttttctcccttctttt |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21189096 |
tagatctttatgagaaaaaaaattaaatttttatatgtttgggatttcgaaaatcaatttgctagaataattgagtgcccaaatttttctcccttctttt |
21188997 |
T |
 |
| Q |
210 |
gttcaataga |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
21188996 |
gttcaataga |
21188987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 217
Target Start/End: Complemental strand, 21205250 - 21205179
Alignment:
| Q |
146 |
gtttgggatttcgaaaatcaatttgctagtataattgagtgcccaaatttttctcccttcttttgttcaata |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||| ||||||| ||| ||||||||| |||| |
|
|
| T |
21205250 |
gtttgggatttcgaaaatcaatatgctaaaataattcagtgcccgaatttttttcctgtcttttgttgaata |
21205179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 21155374 - 21155328
Alignment:
| Q |
21 |
ataaaacacccttctatacatgtgagctaagtatattgttccaaccc |
67 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||| |||||||||| |
|
|
| T |
21155374 |
ataaaacaaccttctatacatgtgaacgaagtatatggttccaaccc |
21155328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 219
Target Start/End: Original strand, 21658907 - 21658993
Alignment:
| Q |
132 |
ttaaatttttatatgtttgggatttcgaaaatcaatttgctagtataattgagtgcccaaatttttctcccttcttttgttcaataga |
219 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||| | ||||| ||||||||||||| || |||||| ||||||||||||| |||||| |
|
|
| T |
21658907 |
ttaaattttcagatgtttgggatttcaaaaatcagtctgctaaaataattgagtgcctaattttttc-cccttcttttgttaaataga |
21658993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University