View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15845_high_14 (Length: 217)
Name: NF15845_high_14
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15845_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 51 - 188
Target Start/End: Complemental strand, 43565137 - 43565000
Alignment:
| Q |
51 |
atggctccaccaaattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttcc |
150 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
43565137 |
atggctccaccgaattccacaaaccttgatctcatcaaaactgagtctttatttgatttatctgagggaaagtttaaggttagagatgtttctttgttcc |
43565038 |
T |
|
| Q |
151 |
atgatgttcctgagaatgtttctttcagttcattctct |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
43565037 |
atgatgttcctgagaatgtttctttcggttctttctct |
43565000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 68 - 204
Target Start/End: Complemental strand, 36433075 - 36432939
Alignment:
| Q |
68 |
cacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttccatgatgttcctgagaat |
167 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| |||||||||| |||||||| || | || || |||||||||||||| |||||||||||||||||| |
|
|
| T |
36433075 |
cacaacccttgatattgtcaaaactgagtcattgcttgatttatccgagggaaaattcactgttaggggtgttcctttgtttcatgatgttcctgagaat |
36432976 |
T |
|
| Q |
168 |
gtttctttcagttcattctcttctatttgcaaaccct |
204 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
36432975 |
gtttctttcagttcattctcttctatatgtaaaccct |
36432939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 63 - 200
Target Start/End: Original strand, 43973477 - 43973614
Alignment:
| Q |
63 |
aattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttccatgatgttcctg |
162 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||| |||||||||||||| ||||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
43973477 |
aattccacagcccttgatcttgtcaaaactgagtctttatttgatttatccgagggaacatttactgtgaaaggcgttcctttgttccatgatgttccta |
43973576 |
T |
|
| Q |
163 |
agaatgtttctttcagttcattctcttctatttgcaaa |
200 |
Q |
| |
|
| ||||||||||| ||||| |||||| |||| |||||| |
|
|
| T |
43973577 |
acaatgtttcttttagttctttctctgctatatgcaaa |
43973614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 200
Target Start/End: Original strand, 8952102 - 8952173
Alignment:
| Q |
129 |
gtgagaggtgttcctttgttccatgatgttcctgagaatgtttctttcagttcattctcttctatttgcaaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| | | |||| |||| ||||| ||||| |||| |||||| |
|
|
| T |
8952102 |
gtgaaaggtgttcctttgttccatgatgttcctaacagtgttccttttagttctgtctctgctatatgcaaa |
8952173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University