View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15845_high_15 (Length: 209)
Name: NF15845_high_15
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15845_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 40398928 - 40398757
Alignment:
| Q |
20 |
ctgttttagtgtattttgtctgttcagttctggtttgcttcatgtggggttcgataggctcgaaagggccgttaatgctcgttgtatctgttgcaagggt |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
40398928 |
ctgttttagtgtattttgtttgttcagttctggtttgcttcatgtggggttcgataggctcgaaagggctattaatgctcgttgtatctgttgc-agggc |
40398830 |
T |
 |
| Q |
120 |
tgttggttcgtgaatctatttgtgttggcaattggttcatacaccatacataaaagtaaataaaaagatcctt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40398829 |
tgttggttcgtgaatctatttgtgttggcaattggttcatacaccatacataaaagtaaataaaaagatcctt |
40398757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 24316385 - 24316429
Alignment:
| Q |
54 |
ttgcttcatgtggggttcgataggctcgaaagggccgttaatgct |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24316385 |
ttgcttcgtgtggggttcgataggctcgaaagggcttttaatgct |
24316429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University