View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15845_low_19 (Length: 209)

Name: NF15845_low_19
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15845_low_19
NF15845_low_19
[»] chr7 (1 HSPs)
chr7 (34-126)||(44954804-44954897)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 44954897 - 44954804
Alignment:
34 cagagtaagaaatagcagaggaaagtgaagggaagtgaaaaaccttactctatgatgggg-atatatagtaaaatttcacacgttcttttgcag 126  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||    
44954897 cagagtaagaaatagcagaggaaagtgaagggaagtgaaaatccttactctatgatggggtatatatagtaaaatttcacacgttcttttgcag 44954804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University