View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15846_low_11 (Length: 223)
Name: NF15846_low_11
Description: NF15846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15846_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 25 - 151
Target Start/End: Complemental strand, 43148539 - 43148414
Alignment:
| Q |
25 |
gcaacatgtcatgatgcttgatggaagaaagggccaacaagctgtgaaattgaaattacatgtttttcttgaaataccatttaannnnnnnncattttgt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
43148539 |
gcaacatgtcatgatgcttgatggaagaaagggccaacaagctgtgaaattgaaattacatgtttttcttgaaattccgtttaa-tttttttcattttgc |
43148441 |
T |
|
| Q |
125 |
gtttatgttgttgcataaattttaaga |
151 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
43148440 |
gtctatgttgttgcataaattttaaga |
43148414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 211
Target Start/End: Complemental strand, 43148346 - 43148316
Alignment:
| Q |
181 |
cgttttaatcctcataagaattttcttcgac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43148346 |
cgttttaatcctcataagaattttcttcgac |
43148316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University