View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15847_high_10 (Length: 220)
Name: NF15847_high_10
Description: NF15847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15847_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 6633968 - 6633767
Alignment:
| Q |
1 |
aaaaggtgtgcataataaaccaatagagttttcttgagataaattaggactatttacnnnnnnnnnnnnnngtgcatcatgcatggaactttcttcaaag |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6633968 |
aaaaagtgtgcataataaaccaatagagttttcttgagataaattaggattatttacttttttttttttttgtgcatcatgcatggaactttcttcaaag |
6633869 |
T |
|
| Q |
101 |
ttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttgcacaggaagagacttcggctaaggaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633868 |
ttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttgcacaggaagagacttcggctaaggaagaa |
6633769 |
T |
|
| Q |
201 |
gt |
202 |
Q |
| |
|
|| |
|
|
| T |
6633768 |
gt |
6633767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University