View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15849_high_14 (Length: 312)
Name: NF15849_high_14
Description: NF15849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15849_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 30 - 143
Target Start/End: Original strand, 39782889 - 39783002
Alignment:
| Q |
30 |
atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39782889 |
atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat |
39782988 |
T |
 |
| Q |
130 |
gtcagctcaatttc |
143 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39782989 |
gtcagctcaatttc |
39783002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University