View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15849_high_20 (Length: 301)
Name: NF15849_high_20
Description: NF15849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15849_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 39783109 - 39782889
Alignment:
| Q |
3 |
ataaaggtggacaagaaaaggctcaaatcaaatttgatcttgaaaggcctgcagaggagcacactgcagaatcagatgacgaggagctagagatcatcga |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39783109 |
ataaaggtggacaagaaaagactcaaatcaaatttgatcttgaaaggcctgcagaggagcacactgcagaatcagatgacgaggggctagagatcatcga |
39783010 |
T |
|
| Q |
103 |
cgagactgaaattgagctgacattaggcccgtcgagttatgaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtcttca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783009 |
cgagactgaaattgagctgacattaggcccgtcgagttataaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtcttca |
39782910 |
T |
|
| Q |
203 |
tcttcaactggatcaagtgat |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39782909 |
tcttcaactggatcaagtgat |
39782889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University