View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_high_18 (Length: 274)
Name: NF1584_high_18
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 34669210 - 34669444
Alignment:
| Q |
18 |
acatgatagacgagtccggaaatgaagttttatcaatggattttaccaatgatgatctcaatgggttgctagcttccatttcctctgaaaattcatgtga |
117 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34669210 |
acatgatagacgggtcaggaaatgaagttttatcgatggattttacaaatgatgatctcaacgggttgctagcttccatttcctctaaaaattcatgtga |
34669309 |
T |
|
| Q |
118 |
ttggaatctcaaatatgctcatgaagaaaaccataaagatctgagagaagttttttcttcgtgtgaagaaggaataacttcagtagaatttgattcttca |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34669310 |
ttggaatctaaaatatgctcatgaagaaaaccataaagatctgagagaagttttttcttcgtttgaagaaggaataacttcagtagaatttgattcttca |
34669409 |
T |
|
| Q |
218 |
tcttttaaggaccaattcaaagataccatagaagc |
252 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
34669410 |
tcttttaatgaccaattcaaagataccatagaagc |
34669444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University