View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_high_27 (Length: 225)
Name: NF1584_high_27
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 38716298 - 38716385
Alignment:
| Q |
1 |
tttttatttcattctttatgggattttgagccaattataaaatttccatgcatgatctttgccttgagaacatgatgaggctgatgag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38716298 |
tttttatttcattctttatgggattttgagccaattataaaatttccatgcatgatctttgccttgagaacatgatgaggctgatgag |
38716385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 38716447 - 38716510
Alignment:
| Q |
150 |
gctcaagagtatgcaaagtctcaaaactttagaactaaatctatgtcaaagtttagtcctaatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38716447 |
gctcaagagtatgcaaagtctcaaaactttagaactaaatctatgtcaaagtttagtcctaatt |
38716510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University