View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_high_29 (Length: 215)
Name: NF1584_high_29
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_high_29 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 9589647 - 9589458
Alignment:
| Q |
12 |
atgaatattttttagagggatgaatggagagtcttaacatgataatgtaaccataccaatgtattgtaaagtactagagttggttaggtatttctggttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
9589647 |
atgaatattttttagagggatgaatggaaagtcttcacatgataatgtaaccatat-------------ag-actagagttggttaggtatttctggttt |
9589562 |
T |
|
| Q |
112 |
tattttgcagaagtttatgaatatagagttgggtattgccaacttcattcttcggaagtttcccagtatgtcccctttgcctaaattattctgcttgcga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9589561 |
tattttgcagaagtttatgaatatagagttgggtattgccaacttcattcttcggaagtttcccagtatgtcccctttgcctaaattattctgcttgcga |
9589462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University