View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_high_6 (Length: 390)
Name: NF1584_high_6
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 351 - 385
Target Start/End: Complemental strand, 4661065 - 4661031
Alignment:
| Q |
351 |
aagctagcacccaattgtttatttatgactttttt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661065 |
aagctagcacccaattgtttatttatgactttttt |
4661031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University