View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_low_11 (Length: 334)
Name: NF1584_low_11
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 73 - 297
Target Start/End: Original strand, 9604395 - 9604611
Alignment:
| Q |
73 |
tataaatcactatttttgaccaaaacctttgttcggtcttgcagccaaaatgtgataaatattaagaaacaaatgtagtgaacgcttgagtgtaagtatg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9604395 |
tataaatcactatttttgaccaaaacctttgttc--------agccaaaatgtgataaatattaagaaacaaatgtagtgaacgcttgagtgtatgtatg |
9604486 |
T |
|
| Q |
173 |
tgaccttccattgctccatgagcaacacatgaagtgtgtaagcatgcacgcttggatcattggaacagcttggatctgtattgcagatatgagaaggcaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9604487 |
tgaccttccattgctccatgagcaacacatgaagtgcgtatgcatgcacgcttggatcattggaacagcttggatctgtattgcagatatgagaaggcaa |
9604586 |
T |
|
| Q |
273 |
tattctttctgttattgactactca |
297 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9604587 |
tattctttctgttattgactactca |
9604611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 242 - 296
Target Start/End: Complemental strand, 9571619 - 9571565
Alignment:
| Q |
242 |
ttggatctgtattgcagatatgagaaggcaatattctttctgttattgactactc |
296 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9571619 |
ttggatctgtatcgcagaaatgagaaggcaatattctttcagttattgactactc |
9571565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 334
Target Start/End: Original strand, 9605240 - 9605278
Alignment:
| Q |
296 |
caagctgaatgacacaactgaaatgaagtgcttttccaa |
334 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9605240 |
caagctgaatgacacaactgaaatgtagtgcttttccaa |
9605278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University