View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_low_15 (Length: 310)
Name: NF1584_low_15
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 135 - 294
Target Start/End: Original strand, 36792438 - 36792597
Alignment:
| Q |
135 |
gttggaaaattatcgcttttgtgttttgattaattttaggtgatatggttttggttactttaatttagaaatagttgcttgaaacttattgtttgtttgt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36792438 |
gttggaaaattatcgcttttgtgttttgattaattttagatgatatggttttggttactttaatttagaaatagttgcttgaaacttattgtttgtttgt |
36792537 |
T |
 |
| Q |
235 |
atcgttgaatgttgatagcggtttaaaaagagaagtattcatgttgtaggaagagaaaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36792538 |
atcgttgaatgttgatagcggtttaaaaagagaagtattcatgttgtaggaagagaaaat |
36792597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 6 - 42
Target Start/End: Original strand, 36792300 - 36792336
Alignment:
| Q |
6 |
gtcgaagaaaattttatcaactgaaacgaaaagttga |
42 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36792300 |
gtcgaagaaaattttatcaaccgaaacgaaaagttga |
36792336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University