View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_low_16 (Length: 301)
Name: NF1584_low_16
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 124 - 286
Target Start/End: Original strand, 48203242 - 48203404
Alignment:
| Q |
124 |
aggattctggaatttgaacgaagagtgaagactgagagggtttcctctgcctgcaaagtcctaagggaaaaattagaagtgggagaagaaatagcaagct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203242 |
aggattctggaatttgaacgaagagtgaagactgagagggtttcctctgcctgcaaagtcctgagggaaaaattagaagtgggagaagaaatagcaagct |
48203341 |
T |
|
| Q |
224 |
tttgctttctttggtttggaggaaggaatccgaaaatgtttgcttgaatttaggtgttgaagg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203342 |
tttgctttctttggtttggaggaaggaatccgaaaatgtttgcttgaatttaggtgttgaagg |
48203404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 48203118 - 48203174
Alignment:
| Q |
1 |
tgtattaatgagatgttgccaagaggtactctccttcccatgacaaacaaacattca |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203118 |
tgtattaatgagatgttaccaagaggtactctccttcccatgacaaacaaacattca |
48203174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University