View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1584_low_24 (Length: 243)
Name: NF1584_low_24
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1584_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 43947304 - 43947098
Alignment:
| Q |
22 |
ttaccaaaggagttaaaaatcaaaactttatgagatgtgtttcaaagaaatgaaaacccataaagattaagcatgaaattaggaggaaaccgaggaacaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43947304 |
ttaccaaaggagttaaaaatcaaaactttatgagatgtgtttcaaagaaatgaaaacccataaagattaagcatgaaattacgaggaaaccgaggaacaa |
43947205 |
T |
|
| Q |
122 |
ggatactgattcatcaaggaggtttttccaaccctggcaatgaaaatgaaggaaaaagcatgatttgaatggaaaaaacggtactgcagagaaaggaggg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947204 |
ggatactgattcatcaaggaggtttttccaaccctggcaatgaaaatgaaggaaaaagcatgatttgaatggaaaaaacggtactgcagagaaaggaggg |
43947105 |
T |
|
| Q |
222 |
aaaaagg |
228 |
Q |
| |
|
||||||| |
|
|
| T |
43947104 |
aaaaagg |
43947098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 156
Target Start/End: Original strand, 14294708 - 14294744
Alignment:
| Q |
120 |
aaggatactgattcatcaaggaggtttttccaaccct |
156 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14294708 |
aaggatactgattcatcaaagatgtttttccaaccct |
14294744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University