View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1584_low_6 (Length: 390)

Name: NF1584_low_6
Description: NF1584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1584_low_6
NF1584_low_6
[»] chr1 (1 HSPs)
chr1 (351-385)||(4661031-4661065)


Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 351 - 385
Target Start/End: Complemental strand, 4661065 - 4661031
Alignment:
351 aagctagcacccaattgtttatttatgactttttt 385  Q
    |||||||||||||||||||||||||||||||||||    
4661065 aagctagcacccaattgtttatttatgactttttt 4661031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University