View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15850_low_11 (Length: 247)
Name: NF15850_low_11
Description: NF15850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15850_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 4 - 141
Target Start/End: Complemental strand, 4859960 - 4859824
Alignment:
| Q |
4 |
gatgtcgaagaatataaaacatttaaatataattttttaatctatcttctatggggacatttgtgataaggtactaaaaccagaaggcacagataaaaga |
103 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
4859960 |
gatgttgaataatataaaacatttaaatataattttttaacttatcttctatggg-acatttgtgataaggtactaaaaccagaaggtacaaataaaaga |
4859862 |
T |
 |
| Q |
104 |
ttaataaagagcagaaataacgtaccaagttgtttcac |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4859861 |
ttaataaagagcagaaataacgtaccaagttgtctcac |
4859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 4859774 - 4859718
Alignment:
| Q |
191 |
tattaccttgataagccaaaagagtaagaatctaaggtgaccgtgacaggacataca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4859774 |
tattaccttgataagccaaaagagtaagaatctaaggtgaccgtgacaggacataca |
4859718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University