View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15851_high_4 (Length: 281)
Name: NF15851_high_4
Description: NF15851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15851_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 9499846 - 9500113
Alignment:
| Q |
1 |
atttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataaggctaggttgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9499846 |
atttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataaggctaggttgttg |
9499945 |
T |
|
| Q |
101 |
tttattactgtttgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgtttttgcataact- |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9499946 |
tttattactgtctgctgaccgttctggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg-ttttgcataactt |
9500044 |
T |
|
| Q |
200 |
------ttcnnnnnnngtgtgatgttgtgtaatttaaactctaccgccccctgtttttgcattcttttac |
263 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9500045 |
atgttcttttttttgtgtgtgatgttgtgtaatttaaactctaccgccccctg-ttttgcattcttttac |
9500113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University