View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15851_low_7 (Length: 267)
Name: NF15851_low_7
Description: NF15851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15851_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 43615364 - 43615135
Alignment:
| Q |
19 |
tctattccctttcaattttcaataccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615364 |
tctattccctttcaattttcaataccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactg |
43615265 |
T |
|
| Q |
119 |
ttcttgaaatctaccctactcaagattgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcattcatgccctacatctacttatgg |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43615264 |
ttcttgcaatctaccctactcaagattgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcatgcatgccctacatctacttatgg |
43615165 |
T |
|
| Q |
219 |
gtcgattatattattcttcacacagtcaca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43615164 |
gtcgattatattattcttcacacagtcaca |
43615135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University