View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15852_high_2 (Length: 257)
Name: NF15852_high_2
Description: NF15852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15852_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 6104102 - 6103873
Alignment:
| Q |
18 |
tgtgcttcttaactcttgaatactatcagctttgtgtggtttagttgtctgtttcttgtttggctaattactgatattgatcaactgcagaaattagccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6104102 |
tgtgcttcttaactcttgaatactatcagctttgtgtggtttagttgtctatttcttgtttggctaattactgatattgatcaactgcagaaattagccg |
6104003 |
T |
 |
| Q |
118 |
acagtagttcttcaactccacaaaatgtagtctcacctccacaagatgtagtgcgtagagggnnnnnnntagcattcgctgatgaagcaggtggaaagct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6104002 |
acagtagttcttcaactccacaaaatgtagtctcacctccacaagatgtagtgcgtaaagggaaaaaaatagcattcgctgatgaagcaggtggaaagct |
6103903 |
T |
 |
| Q |
218 |
gtgtcaggttaggttctatgaggatgatga |
247 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
6103902 |
gtgccaggttaggttctatgaggatgatga |
6103873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University