View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15852_high_4 (Length: 239)
Name: NF15852_high_4
Description: NF15852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15852_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 24 - 228
Target Start/End: Complemental strand, 37964782 - 37964578
Alignment:
| Q |
24 |
actagtatcttagatctcataaacctttgaaaactgtattccatgtgtttattcatttcacgagacaatttgttgaaccatatgtaaatccaattgggtg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37964782 |
actagtatcttagatctcataaacctttgaaaactgtattccatgtgtttattcatttcacgagacaatttgttgaaccatatgtaaatccaattgggtg |
37964683 |
T |
 |
| Q |
124 |
aactccgtcttgtagttattagttaactagcttgctttgatgtaggtttacttcacagtttagagatgaaatcaaaatacctcgtgggtctgtaattcat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37964682 |
aactccgtcttgtagttattagttaactagcatgctttgatgtaggtttacttcacagtttagagatgaaatcaaaatacctcgtgggtctgtaattcat |
37964583 |
T |
 |
| Q |
224 |
ctcac |
228 |
Q |
| |
|
||||| |
|
|
| T |
37964582 |
ctcac |
37964578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University