View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15852_low_6 (Length: 243)
Name: NF15852_low_6
Description: NF15852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15852_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 51 - 188
Target Start/End: Complemental strand, 14772263 - 14772126
Alignment:
| Q |
51 |
acccacattttattgatgaataaataagaatctgtcattcttatatctcattcnnnnnnnaaaacaccaatagtggcgctaccaatagcaaactcaaatc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14772263 |
acccacattttattgatgaataaataagaatctgtcattcatatatctcattctttttttaaaacaccaatagtggcgctaccaatagcaaactcaaatc |
14772164 |
T |
|
| Q |
151 |
aattttttggaataggttatcttagttggtggttttgc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14772163 |
aattttttggaataggttatcttagttggtggttttgc |
14772126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 14772396 - 14772356
Alignment:
| Q |
10 |
tatcattatcctaatttggaacaatattttcctattcctta |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14772396 |
tatcattatcctaatttggaacaatattttcctattcctta |
14772356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University