View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15853_high_4 (Length: 327)
Name: NF15853_high_4
Description: NF15853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15853_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 90 - 285
Target Start/End: Original strand, 18639968 - 18640157
Alignment:
| Q |
90 |
atccataaatatatgtaaatactcgtcggtatcttaaattttcgtagatcatccatttattggacactagtgcgaatatgtgacatacataaatatccat |
189 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18639968 |
atccataaatatctgtaaatactggtcggtactttaaattt-cgtagatcatccatttattggacactagtgcgaatatgtgacatacataaatatctat |
18640066 |
T |
 |
| Q |
190 |
ttagtttctctcnnnnnnntaaataaatatccatttagtagtcatacatttagaccgaccctaagaatgtaaaattgaaaagtctatgtaaattat |
285 |
Q |
| |
|
|||||||||| | ||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
18640067 |
ttagtttctcccaaa-----aaaaaaatatttatctagtagtcatacatttggaccgaccctaagaatgtaaaattgaaaagtgtatgtatattat |
18640157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University